View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0735_low_49 (Length: 258)
Name: NF0735_low_49
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0735_low_49 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 30079372 - 30079236
Alignment:
| Q |
1 |
ctctaaatgcctcattctgtcctgccaattgaacacatcagcatcttttgcagggtggaaatatgtaggataaggaatcccaaaatcatttgcattccat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30079372 |
ctctaaatgcctcattctgtcctgccaattgaacacatcagcatcttttgcagggtggaagtatgtaggataaggaatcccaaaatcatttgcattccat |
30079273 |
T |
|
| Q |
101 |
ggactcgactctaccacaagcatggacatattcttcg |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30079272 |
ggactcgactctaccacaagcatggacatattcttcg |
30079236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 43 - 135
Target Start/End: Original strand, 39485817 - 39485909
Alignment:
| Q |
43 |
atcttttgcagggtggaaatatgtaggataaggaatcccaaaatcatttgcattccatggactcgactctaccacaagcatggacatattctt |
135 |
Q |
| |
|
|||||| || || |||||||| || ||||||||||||||||||||||| |||||||| ||||| || || || |||||||| ||||||||||| |
|
|
| T |
39485817 |
atctttcgcgggatggaaatacgtcggataaggaatcccaaaatcattagcattccaaggactagattcaacaacaagcatagacatattctt |
39485909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5150 times since January 2019
Visitors: 4845