View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0735_low_50 (Length: 258)

Name: NF0735_low_50
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0735_low_50
NF0735_low_50
[»] chr1 (1 HSPs)
chr1 (1-115)||(30079348-30079462)
[»] chr7 (1 HSPs)
chr7 (23-114)||(39485686-39485777)


Alignment Details
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 30079348 - 30079462
Alignment:
1 gcaggacagaatgaggcatttagagaggaagtggctcttctcatttgctggagctccccgtcctgacaatgccaaatcaatcaggggtcagttaattgag 100  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30079348 gcaggacagaatgaggcatttagagaggaagtggcttttctcatttgctggagctccccgtcctgacaatgccaaatcaatcaggggtcagttaattgag 30079447  T
101 caatgcagaagttca 115  Q
    |||||||||||||||    
30079448 caatgcagaagttca 30079462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 23 - 114
Target Start/End: Complemental strand, 39485777 - 39485686
Alignment:
23 gagaggaagtggctcttctcatttgctggagctccccgtcctgacaatgccaaatcaatcaggggtcagttaattgagcaatgcagaagttc 114  Q
    |||||||| ||||| ||||| ||||| || || || |||||||  ||||| ||||| || ||||||||| ||||||||||||| || |||||    
39485777 gagaggaaatggcttttctcttttgcgggtgcacctcgtcctggtaatgcaaaatcgattaggggtcagataattgagcaatgtaggagttc 39485686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University