View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0735_low_53 (Length: 256)
Name: NF0735_low_53
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0735_low_53 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 12 - 238
Target Start/End: Original strand, 30079236 - 30079462
Alignment:
| Q |
12 |
cgaagaatatgtccatgcttgtggtagagtcgagtccatggaatgcaaatgattttgggattccttatcctacatatttccaccctgcaaaagatgctga |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30079236 |
cgaagaatatgtccatgcttgtggtagagtcgagtccatggaatgcaaatgattttgggattccttatcctacatacttccaccctgcaaaagatgctga |
30079335 |
T |
 |
| Q |
112 |
tgtgttcaattggcaggacagaatgaggcatttagagaggaagtggctcttctcatttgctggagctccccgtcctgacaatgccaaatcaatcaggggt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30079336 |
tgtgttcaattggcaggacagaatgaggcatttagagaggaagtggcttttctcatttgctggagctccccgtcctgacaatgccaaatcaatcaggggt |
30079435 |
T |
 |
| Q |
212 |
cagttaattgagcaatgcagaagttca |
238 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
30079436 |
cagttaattgagcaatgcagaagttca |
30079462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 14 - 237
Target Start/End: Complemental strand, 39485909 - 39485686
Alignment:
| Q |
14 |
aagaatatgtccatgcttgtggtagagtcgagtccatggaatgcaaatgattttgggattccttatcctacatatttccaccctgcaaaagatgctgatg |
113 |
Q |
| |
|
||||||||||| |||||||| || || || ||||| |||||||| ||||||||||||||||||||||| || |||||||| || || |||||| |||| |
|
|
| T |
39485909 |
aagaatatgtctatgcttgttgttgaatctagtccttggaatgctaatgattttgggattccttatccgacgtatttccatcccgcgaaagataaggatg |
39485810 |
T |
 |
| Q |
114 |
tgttcaattggcaggacagaatgaggcatttagagaggaagtggctcttctcatttgctggagctccccgtcctgacaatgccaaatcaatcaggggtca |
213 |
Q |
| |
|
| || ||||||||| || ||||| || |||||||| ||||| ||||| ||||| || || || ||||||| ||||| ||||| || |||||||| |
|
|
| T |
39485809 |
tttttgtttggcaggagaggatgagaaggttggagaggaaatggcttttctcttttgcgggtgcacctcgtcctggtaatgcaaaatcgattaggggtca |
39485710 |
T |
 |
| Q |
214 |
gttaattgagcaatgcagaagttc |
237 |
Q |
| |
|
| ||||||||||||| || ||||| |
|
|
| T |
39485709 |
gataattgagcaatgtaggagttc |
39485686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University