View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0735_low_54 (Length: 256)

Name: NF0735_low_54
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0735_low_54
NF0735_low_54
[»] chr4 (1 HSPs)
chr4 (11-216)||(24270036-24270241)


Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 11 - 216
Target Start/End: Original strand, 24270036 - 24270241
Alignment:
11 agaacctgtggttgcccaaagaagattacgagattcagtgggatgggaatgattgacatgaacgatatagagtgtatcaccggtacgaagaagattatcg 110  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
24270036 agaaccagtggttgcccaaagaagattacgagattcagtgggatgggaatgattgacatgaacgatatagagtgtatcaccggtacgaagaagattgtcg 24270135  T
111 atagcccatttgagagcgatcttgcttcctttggagaaatctaaagctacaccaatttgcctaccactcgccatgtttttctttttggtgaacagcacag 210  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||     
24270136 atagcccatttgagagcgatcttgcttcctttggagaaatctaaagctacaccaatttgccttccactcgccatgtttttctttttggtgaacagcacaa 24270235  T
211 gttctg 216  Q
    ||||||    
24270236 gttctg 24270241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University