View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0735_low_54 (Length: 256)
Name: NF0735_low_54
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0735_low_54 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 11 - 216
Target Start/End: Original strand, 24270036 - 24270241
Alignment:
| Q |
11 |
agaacctgtggttgcccaaagaagattacgagattcagtgggatgggaatgattgacatgaacgatatagagtgtatcaccggtacgaagaagattatcg |
110 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
24270036 |
agaaccagtggttgcccaaagaagattacgagattcagtgggatgggaatgattgacatgaacgatatagagtgtatcaccggtacgaagaagattgtcg |
24270135 |
T |
|
| Q |
111 |
atagcccatttgagagcgatcttgcttcctttggagaaatctaaagctacaccaatttgcctaccactcgccatgtttttctttttggtgaacagcacag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
24270136 |
atagcccatttgagagcgatcttgcttcctttggagaaatctaaagctacaccaatttgccttccactcgccatgtttttctttttggtgaacagcacaa |
24270235 |
T |
|
| Q |
211 |
gttctg |
216 |
Q |
| |
|
|||||| |
|
|
| T |
24270236 |
gttctg |
24270241 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4260 times since January 2019
Visitors: 4832