View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0735_low_56 (Length: 252)
Name: NF0735_low_56
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0735_low_56 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 30 - 252
Target Start/End: Original strand, 47828604 - 47828826
Alignment:
| Q |
30 |
taaagagtaatgctggattgttctgttgggttgatatgaggcatttattgagttctgcaacttttgaggcagagaatgagctttggaaaaggattcttta |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47828604 |
taaagagtaatgctggattgttctgttgggttgatatgaggcatttattgagttctgcaacttttgaggcagagaatgagctttggaaaaggattcttta |
47828703 |
T |
|
| Q |
130 |
ccaaattggtttgaatatatctcctggatcttcttgtcattgttctgaacctggctggtttaggatttgctttgctaatatgtctcaagaagctttgcaa |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47828704 |
ccaaattggtttgaatatatctcctggatcttcttgtcattgttctgaacctgggtggtttaggatttgctttgctaatatgtctcaagaagctttgcaa |
47828803 |
T |
|
| Q |
230 |
gttgcaatgcgaaggattaagat |
252 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
47828804 |
gttgcaatgcgaaggattaagat |
47828826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 140 - 211
Target Start/End: Complemental strand, 42788893 - 42788822
Alignment:
| Q |
140 |
ttgaatatatctcctggatcttcttgtcattgttctgaacctggctggtttaggatttgctttgctaatatg |
211 |
Q |
| |
|
|||||||||||||| || | ||||||||||||| | ||||||| |||||||| | ||||||||||||||| |
|
|
| T |
42788893 |
ttgaatatatctccggggtgttcttgtcattgtgatcaacctggttggtttagagtctgctttgctaatatg |
42788822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 140 - 211
Target Start/End: Complemental strand, 42798431 - 42798360
Alignment:
| Q |
140 |
ttgaatatatctcctggatcttcttgtcattgttctgaacctggctggtttaggatttgctttgctaatatg |
211 |
Q |
| |
|
|||||||||||||| || | ||||||||||||| | ||||||| |||||||| | ||||||||||||||| |
|
|
| T |
42798431 |
ttgaatatatctccggggtgttcttgtcattgtgatcaacctggttggtttagagtctgctttgctaatatg |
42798360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5485 times since January 2019
Visitors: 4854