View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0735_low_72 (Length: 218)
Name: NF0735_low_72
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0735_low_72 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 58; Significance: 1e-24; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 32215734 - 32215823
Alignment:
Q |
1 |
agtatggattatctttatgtttttttaatttaattnnnnnnnnctttttctttattattcttttatgttagaaattccgtctttattgtg |
90 |
Q |
|
|
|||||||||||||||||||| |||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32215734 |
agtatggattatctttatgtctttttaatttgattaaaaaaaactttttctttattattcttttatgttagaaattccgtctttattgtg |
32215823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3887 times since January 2019
Visitors: 4823