View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0735_low_73 (Length: 216)

Name: NF0735_low_73
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0735_low_73
NF0735_low_73
[»] chr7 (1 HSPs)
chr7 (17-135)||(43287167-43287285)


Alignment Details
Target: chr7 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 17 - 135
Target Start/End: Original strand, 43287167 - 43287285
Alignment:
17 gaacctgtgttcgtgcaaattttttccatttatgtgaaaatatgcaattgatgcatttgtctcctgaaacttgtgacaggcatgtgatgcctcacctaat 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43287167 gaacctgtgttcgtgcaaattttttccatttatgtgaaaatatgcaattgatgcatttgtctcctgaaacttgtgacaggcatgtgatgcctcacctaat 43287266  T
117 caagatcttggttgctttc 135  Q
    |||||||||||||||||||    
43287267 caagatcttggttgctttc 43287285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University