View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0735_low_74 (Length: 215)
Name: NF0735_low_74
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0735_low_74 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 1 - 186
Target Start/End: Complemental strand, 6119149 - 6118964
Alignment:
| Q |
1 |
aaatcgattatgtatgattttaacgaaaatcgtgtggttcgggtttacccggagttaacgggtggaccgagaaattatccgtcggcggggagttcggtga |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6119149 |
aaatcggttatgtatgattttaacgaaaatcgtgtggttcgggtttacccggagttaacgggtggaccgagaaattatccgtcggcggggagttcggtga |
6119050 |
T |
|
| Q |
101 |
tgcttgctttagaaggtgaattttcagaggcggtggttgttgtttgtggcggtgctcaatacggtgcgtttcttgaacggaatacg |
186 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6119049 |
tgctggctttagaaggtgaattttcagaggcggtggttgttgtttgtggcggtgctcaatacggtgcgtttcttgaacggaatacg |
6118964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3389 times since January 2019
Visitors: 4813