View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0735_low_76 (Length: 214)
Name: NF0735_low_76
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0735_low_76 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 103 - 214
Target Start/End: Complemental strand, 25655206 - 25655095
Alignment:
| Q |
103 |
cctgtccccacgatgttagcacaccacctttgcaacagttcgtgtattgcatattgtaagatgctcctggtaataagtcaacaacttgaggacttctctt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25655206 |
cctgtccccacgatgttagcacaccacctttgcaacaattcgtgtattgcatattgtaagatgctcctggtaataagtcaacaacttgaggacttctctt |
25655107 |
T |
 |
| Q |
203 |
gcaactatgagg |
214 |
Q |
| |
|
|||||||||||| |
|
|
| T |
25655106 |
gcaactatgagg |
25655095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University