View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0735_low_78 (Length: 210)

Name: NF0735_low_78
Description: NF0735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0735_low_78
NF0735_low_78
[»] chr2 (1 HSPs)
chr2 (99-210)||(25655095-25655206)


Alignment Details
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 99 - 210
Target Start/End: Complemental strand, 25655206 - 25655095
Alignment:
99 cctgtccccacgatgttagcacaccacctttgcaacagttcgtgtattgcatattgtaagatgctcctggtaataagtcaacaacttgaggacttctctt 198  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25655206 cctgtccccacgatgttagcacaccacctttgcaacaattcgtgtattgcatattgtaagatgctcctggtaataagtcaacaacttgaggacttctctt 25655107  T
199 gcaactatgagg 210  Q
    ||||||||||||    
25655106 gcaactatgagg 25655095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University