View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0736_high_2 (Length: 430)
Name: NF0736_high_2
Description: NF0736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0736_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 3e-89; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 3e-89
Query Start/End: Original strand, 118 - 300
Target Start/End: Complemental strand, 29036053 - 29035871
Alignment:
| Q |
118 |
taatcaatctcagttgcaacgtgatgacacaaaagatggagaaggagattctactgatttcactactggtgctccttgcttacctcacaagaacaagcct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29036053 |
taatcaatctcagttgcaacgtgatgacacaaaagatggagaaggagattctactgatttcactcctggtgctccttgtttacctcacaagaacaagcct |
29035954 |
T |
 |
| Q |
218 |
caaacacttggtcataaattttgatgataaaataagaacatagaaatattaattatgtgttccatatgtatattaattttaac |
300 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29035953 |
caaacacttggtcataaattttaatgataaaataagaacatagaagtattaattatgtgttccatatgtatattaattttaac |
29035871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 265 - 323
Target Start/End: Complemental strand, 29035870 - 29035812
Alignment:
| Q |
265 |
attaattatgtgttccatatgtatattaattttaacttttctgtgtgttttctgatacc |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29035870 |
attaattatgtgttccatatgtatattaattttaacttttgtgtgtgttttctgatacc |
29035812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University