View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0736_high_8 (Length: 341)
Name: NF0736_high_8
Description: NF0736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0736_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-115
Query Start/End: Original strand, 82 - 292
Target Start/End: Original strand, 48793882 - 48794092
Alignment:
Q |
82 |
gagatgaaatggatattgactcttgtttaattacttttatgttaaaggaattgttacgtaactacaagtctacgaaacccaatccccaaactgaagaaat |
181 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48793882 |
gagatgaaatggatattgactcttgtttaattacttttatgttaaaggaattgttacgtaactacaagtctacgaaacccaatccccaaactgaagaaat |
48793981 |
T |
 |
Q |
182 |
gaaaaagaattcctacaagtttttgttgtgatttttagcttggctttgcaatttcttgctgttaagttaagggagaaccaaactatgtagaccttgttta |
281 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48793982 |
gaaaaagaattcctacaagtttttgttgtgatttttagcttggctttgcaatttcttgctgttaagttaagggagaaccaaactatgtagaccttgttta |
48794081 |
T |
 |
Q |
282 |
cgtttgaatag |
292 |
Q |
|
|
||||||||||| |
|
|
T |
48794082 |
cgtttgaatag |
48794092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University