View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0736_low_16 (Length: 310)
Name: NF0736_low_16
Description: NF0736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0736_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 5080475 - 5080714
Alignment:
Q |
1 |
caactgcatatgatgcaattgttattctgcctcatttgttgtaaatggtaagctttatcagattctaannnnnnnngacctttcggtttgtattttgttc |
100 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |||||||||||||||| |
|
|
T |
5080475 |
caactgcatatgaggcaattgttattctgcctcatttgttgtaaatggtaagctttatcagattctaattttttttgactttttggtttgtattttgttc |
5080574 |
T |
 |
Q |
101 |
attgtaggatgttttgttgtgtggtgtatatgcacgaagagaggctgattatggcaacattgatcttgcaagaaaggtgtttgacatggcattgctatct |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
5080575 |
attgtaggatgttttgttgtgtggtgtatatgcacgaagagaggctgattatggcaacattgatcttgcaagaaaggtgtttgacatggcattgttatcc |
5080674 |
T |
 |
Q |
201 |
gtggaagggcttcctcccgaggtatgtactgtattctctg |
240 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5080675 |
gtggaagggcttcctcccgaggtatgtactgtattctctg |
5080714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5124 times since January 2019
Visitors: 4845