View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0736_low_18 (Length: 289)
Name: NF0736_low_18
Description: NF0736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0736_low_18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 5e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 39 - 240
Target Start/End: Complemental strand, 35628488 - 35628287
Alignment:
Q |
39 |
tggtatgtgttagtacatcaaaaaagtattttttaactaacaagttcaagatttgatctctgaggctaaccaatcttcttcaccctaacaaataaattac |
138 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35628488 |
tggtatgtgttagtacatcaaaaaagtattttttaactaacaagttcaagatttgatctctgaggctaaccaatcttcttcaccctaacaaataaattac |
35628389 |
T |
 |
Q |
139 |
taataatcggcctatnnnnnnnnnnnnnnnnnnnnnnnntacataaactatactagggacttggattaattgtctcactctttcatagttacataatctg |
238 |
Q |
|
|
|||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35628388 |
taataatctgcctataaaacaaacaagaaaaacaaaaactacataaactatactagggacttggattaattgtctcactctttcatagttacataatctg |
35628289 |
T |
 |
Q |
239 |
tg |
240 |
Q |
|
|
|| |
|
|
T |
35628288 |
tg |
35628287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University