View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0736_low_18 (Length: 289)

Name: NF0736_low_18
Description: NF0736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0736_low_18
NF0736_low_18
[»] chr7 (1 HSPs)
chr7 (39-240)||(35628287-35628488)


Alignment Details
Target: chr7 (Bit Score: 126; Significance: 5e-65; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 39 - 240
Target Start/End: Complemental strand, 35628488 - 35628287
Alignment:
39 tggtatgtgttagtacatcaaaaaagtattttttaactaacaagttcaagatttgatctctgaggctaaccaatcttcttcaccctaacaaataaattac 138  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35628488 tggtatgtgttagtacatcaaaaaagtattttttaactaacaagttcaagatttgatctctgaggctaaccaatcttcttcaccctaacaaataaattac 35628389  T
139 taataatcggcctatnnnnnnnnnnnnnnnnnnnnnnnntacataaactatactagggacttggattaattgtctcactctttcatagttacataatctg 238  Q
    |||||||| ||||||                        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35628388 taataatctgcctataaaacaaacaagaaaaacaaaaactacataaactatactagggacttggattaattgtctcactctttcatagttacataatctg 35628289  T
239 tg 240  Q
    ||    
35628288 tg 35628287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University