View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0736_low_21 (Length: 283)
Name: NF0736_low_21
Description: NF0736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0736_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 46 - 238
Target Start/End: Original strand, 55143278 - 55143470
Alignment:
| Q |
46 |
aaaaatgactatgagcagagcattaaaagtggcagctgagagttaggagtgtgcatctatttggggcgcattcgctcttttaactcacttttgcattcaa |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55143278 |
aaaaatgactatgagcagagcattaaaagtggcagttgagagttaggagtgtgcatctatttggggcgcattcgctcttttaactcacttttgcattcaa |
55143377 |
T |
 |
| Q |
146 |
ctagtatttattgaagtggtcattcatcacattattgtcacacacagtacccatttctcacttgcatttgccaactggacttgtaacattcat |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
55143378 |
ctagtatttattgaagtggtcattcatcacattattgtcacacacagtacccatttctcatttgcatttgccaactggacttgtaacattcat |
55143470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University