View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0736_low_24 (Length: 266)
Name: NF0736_low_24
Description: NF0736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0736_low_24 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 16 - 266
Target Start/End: Original strand, 7831648 - 7831898
Alignment:
| Q |
16 |
agcacagagaaaggatgtacagaatgaagagatgtgtcaagagaaaccgagaggaactggagagagtttgttctggaaaggagtcgaagatgaagtctca |
115 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7831648 |
agcacagagaaaggatgtatagaatgaagagatgtgtcaagagaaaccgagaggaactggagagagtttgttctggaaaggagccgaagatgaagtctca |
7831747 |
T |
 |
| Q |
116 |
gctccaagacgtcgctattggggaagcgttgagttacaagatggagatccacttgtttggagaagctggaatgggaaagaaaccttttgggagagggtga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7831748 |
gctccaagacgtcgctattggggaagcgttgagttacaagatggagatccacttgtttggagaagctggaatgggaaagaaaccttttgggagagggtga |
7831847 |
T |
 |
| Q |
216 |
gaaatattgttattctgttgaaatgccaaaattattctgtagaggaagctt |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7831848 |
gaaatattgttattctgttgaaatgccaaaattgttctgtagaggaagctt |
7831898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University