View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0736_low_30 (Length: 214)

Name: NF0736_low_30
Description: NF0736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0736_low_30
NF0736_low_30
[»] chr8 (1 HSPs)
chr8 (1-124)||(12103461-12103584)


Alignment Details
Target: chr8 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 1 - 124
Target Start/End: Complemental strand, 12103584 - 12103461
Alignment:
Q  1 gtcctttcatcttccatgtagctgctacaaggacttcctcatctccatctcgacagagtgcgcttaatccctaggagttcgcttcagacaggtttgcatc 100  Q
    |||||||||||||||||||||| ||| ||| ||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||    
T  12103584 gtcctttcatcttccatgtagccgctgcaatgacttccccatctccatctcgacagagtgcgcttaatccccaggagttcgcttcagacaggtttgcatc 12103485  T
Q  101 agtgttcattttgtacaaattatt 124  Q
    ||||||||||||||||||||||||    
T  12103484 agtgttcattttgtacaaattatt 12103461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University