View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0736_low_31 (Length: 213)
Name: NF0736_low_31
Description: NF0736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0736_low_31 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 18 - 213
Target Start/End: Complemental strand, 48794092 - 48793897
Alignment:
| Q |
18 |
ctattcaaacgtaaacaaggtctacatagtttggttctcccttaacttaacagcaagaaattgcaaagccaagctaaaaatcacaacaaaaacttgtagg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48794092 |
ctattcaaacgtaaacaaggtctacatagtttggttctcccttaacttaacagcaagaaattgcaaagccaagctaaaaatcacaacaaaaacttgtagg |
48793993 |
T |
 |
| Q |
118 |
aattctttttcatttcttcagtttggggattgggtttcgtagacttgtagttacgtaacaattcctttaacataaaagtaattaaacaagagtcaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48793992 |
aattctttttcatttcttcagtttggggattgggtttcgtagacttgtagttacgtaacaattcctttaacataaaagtaattaaacaagagtcaa |
48793897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University