View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0736_low_32 (Length: 206)

Name: NF0736_low_32
Description: NF0736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0736_low_32
NF0736_low_32
[»] chr7 (1 HSPs)
chr7 (1-106)||(47286804-47286909)


Alignment Details
Target: chr7 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 47286909 - 47286804
Alignment:
1 ttcgatcgaaccgattttggcccttcaaatctccctctttcaaatggccggtgtcgtatggatccattcgacactgcccttaaaattgattgcactgctc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47286909 ttcgatcgaaccgattttggcccttcaaatctccctctttcaaatggccggtgtcgtatggatccattcgacactgcccttaaaattgattgcactgctc 47286810  T
101 actctg 106  Q
    ||||||    
47286809 actctg 47286804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3896 times since January 2019
Visitors: 4823