View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0736_low_33 (Length: 204)
Name: NF0736_low_33
Description: NF0736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0736_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 8e-54; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 8e-54
Query Start/End: Original strand, 75 - 193
Target Start/End: Original strand, 52103200 - 52103318
Alignment:
| Q |
75 |
ggtacagcaacagcagcatgtaaaatactaaaatcgttagatctctctgattgcaaatactcctatctctttattggtggacccggattatgccaaccta |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
52103200 |
ggtacagcaacagcagcatgtaaaatactaaaatccttagatctctctgattgcaaatactcctatgtctttattggtggacccggattatgccaaccaa |
52103299 |
T |
|
| Q |
175 |
atttctccatcttagaata |
193 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
52103300 |
atttctccatcttagaata |
52103318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 24 - 58
Target Start/End: Original strand, 52103155 - 52103189
Alignment:
| Q |
24 |
cctatggctatgtgacaacgtgtagtgtaggaatc |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
52103155 |
cctatggctatgtgacaacgtgtagtgtaggaatc |
52103189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3601 times since January 2019
Visitors: 4816