View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0737_high_15 (Length: 249)
Name: NF0737_high_15
Description: NF0737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0737_high_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 52; Significance: 6e-21; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 182 - 241
Target Start/End: Original strand, 33582100 - 33582159
Alignment:
| Q |
182 |
ttgtttgagcttggagtacttgttttcgtggatttgtccttcgtggaaagtagtattatc |
241 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33582100 |
ttgtttgagcttgaagtacttgttttggtggatttgtccttcgtggaaagtagtattatc |
33582159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 113 - 155
Target Start/End: Original strand, 33582031 - 33582073
Alignment:
| Q |
113 |
ctttatttgaaactaggtaatgaagttaatagtaaagtgtggt |
155 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
33582031 |
ctttatttgagactaggtaatgaagtcaatagtaaagtgtggt |
33582073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4765 times since January 2019
Visitors: 4839