View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0737_high_17 (Length: 236)
Name: NF0737_high_17
Description: NF0737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0737_high_17 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 4 - 236
Target Start/End: Complemental strand, 40968793 - 40968561
Alignment:
Q |
4 |
gcttcaattggttaacatgtccaaggaaggtaacaactttgattgagtgaagtcatataagattaagaggacatatttgatttttgctcctaatgtttgt |
103 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40968793 |
gcttcaattggttaacatgtccaaggaaggtaacaactttgattgagtgaagtcatataagattaagaggacatatttgatttttgctcctaatgtttgt |
40968694 |
T |
 |
Q |
104 |
tgataatctatggtgcaataaattcaggatttatcaactggttggcttgagtgtgaccctgacccaatttttaagccagagtacattccaatgccaggat |
203 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40968693 |
tgataatctatggtgcaataaattcaggatttatcaactggttggcttgagtgtgaccctgacccaatttttaagccagagtacattccaatgccaggat |
40968594 |
T |
 |
Q |
204 |
ttgtttctcattgggtaagtgatgaatctttct |
236 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
40968593 |
ttgtttctcattgggtaagtgatgaatctttct |
40968561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University