View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0737_high_20 (Length: 203)
Name: NF0737_high_20
Description: NF0737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0737_high_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 47299382 - 47299292
Alignment:
| Q |
1 |
taaggaaaaagatactgcttctctagtccatcaatctttcttctttagagcttctgacatagccacacttcgtctcttggtttcatctcac |
91 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
47299382 |
taaggaaaaagatactgcttctctagtccatcaatctttcttctttagagcttctgacatagccacacttcgtctcttggttccatttcac |
47299292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 1 - 91
Target Start/End: Complemental strand, 47292775 - 47292685
Alignment:
| Q |
1 |
taaggaaaaagatactgcttctctagtccatcaatctttcttctttagagcttctgacatagccacacttcgtctcttggtttcatctcac |
91 |
Q |
| |
|
||||||| ||||||||||||||||||| |||| |||||||||||||||||||||||||||||| | ||||||||||||||| ||| |||| |
|
|
| T |
47292775 |
taaggaagaagatactgcttctctagttcatcgatctttcttctttagagcttctgacatagctgcgcttcgtctcttggttccatttcac |
47292685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5526 times since January 2019
Visitors: 4854