View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0737_high_8 (Length: 343)

Name: NF0737_high_8
Description: NF0737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0737_high_8
NF0737_high_8
[»] chr5 (1 HSPs)
chr5 (30-335)||(14965771-14966074)


Alignment Details
Target: chr5 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 30 - 335
Target Start/End: Original strand, 14965771 - 14966074
Alignment:
30 tttgtctagtatgattggaggtgcgattgagggatcttggcataagtcatgagagagaagcaagggttgagtgctcttctatctcttcctgatgcttttg 129  Q
    ||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
14965771 tttgtctagtatgatcggaggtgcgattgagggatcttggcagaagtcatgagagagaagcaagggttgagtgctcttctatctcttcctgatgctttta 14965870  T
130 tttttactggtaggagacattgtgttctgacctattggaagcaagagttgagtgctcttctctctcttctaggttaaaattagaacaaaaagtataagta 229  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||  ||||||    
14965871 tttttactagtaggagacattgtgttctgacctattggaagcaagagttgagtgctcttctctcttttctaggttaaaattagaataaaaag--taagta 14965968  T
230 ccattagtttatattttgtggtatattacaggacctgcgatctttgggatgatgatattgaatgatctttgagtagtacatttttggcagttgttgcctt 329  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||| ||| |||||||| ||| ||    
14965969 ccattagtttatattttgtggtatattacaggacctgcgatctttgggatgatgatattgaatgacttttgagtagtacactttcggcagttgctgcatt 14966068  T
330 catctc 335  Q
    | ||||    
14966069 cttctc 14966074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2610 times since January 2019
Visitors: 4796