View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0737_high_8 (Length: 343)
Name: NF0737_high_8
Description: NF0737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0737_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 30 - 335
Target Start/End: Original strand, 14965771 - 14966074
Alignment:
Q |
30 |
tttgtctagtatgattggaggtgcgattgagggatcttggcataagtcatgagagagaagcaagggttgagtgctcttctatctcttcctgatgcttttg |
129 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14965771 |
tttgtctagtatgatcggaggtgcgattgagggatcttggcagaagtcatgagagagaagcaagggttgagtgctcttctatctcttcctgatgctttta |
14965870 |
T |
 |
Q |
130 |
tttttactggtaggagacattgtgttctgacctattggaagcaagagttgagtgctcttctctctcttctaggttaaaattagaacaaaaagtataagta |
229 |
Q |
|
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |||||| |
|
|
T |
14965871 |
tttttactagtaggagacattgtgttctgacctattggaagcaagagttgagtgctcttctctcttttctaggttaaaattagaataaaaag--taagta |
14965968 |
T |
 |
Q |
230 |
ccattagtttatattttgtggtatattacaggacctgcgatctttgggatgatgatattgaatgatctttgagtagtacatttttggcagttgttgcctt |
329 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |||||||| ||| || |
|
|
T |
14965969 |
ccattagtttatattttgtggtatattacaggacctgcgatctttgggatgatgatattgaatgacttttgagtagtacactttcggcagttgctgcatt |
14966068 |
T |
 |
Q |
330 |
catctc |
335 |
Q |
|
|
| |||| |
|
|
T |
14966069 |
cttctc |
14966074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2610 times since January 2019
Visitors: 4796