View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0737_low_19 (Length: 303)

Name: NF0737_low_19
Description: NF0737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0737_low_19
NF0737_low_19
[»] chr8 (2 HSPs)
chr8 (73-210)||(35382578-35382715)
chr8 (113-198)||(35387657-35387740)


Alignment Details
Target: chr8 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 73 - 210
Target Start/End: Complemental strand, 35382715 - 35382578
Alignment:
73 agacttatcccaatgatctaattacaaaggtacaggaaattaaggcatgagccacagggtgtcagtcaaatagtacgaccggattgtgcaacccaagatt 172  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35382715 agacttatcccaatgatctaattacaaaggtacaggaaattaaggcatgagccacagggtgtcagtcaaatagtacgaccggattgtgcaacccaagatt 35382616  T
173 aattttgaaaaataagggcacaaataatgggaatggat 210  Q
    ||||||||||||||||||||||||||||||||||||||    
35382615 aattttgaaaaataagggcacaaataatgggaatggat 35382578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 113 - 198
Target Start/End: Complemental strand, 35387740 - 35387657
Alignment:
113 taaggcatgagccacagggtgtcagtcaaatagtacgaccggattgtgcaacccaagattaattttgaaaaataagggcacaaata 198  Q
    |||||||||||||||| | | || |||||||||||| |||| |||||||| ||||| |||||||||| ||||||||||||||||||    
35387740 taaggcatgagccacaag-tatctgtcaaatagtacaaccgaattgtgcagcccaatattaattttg-aaaataagggcacaaata 35387657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University