View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0737_low_19 (Length: 303)
Name: NF0737_low_19
Description: NF0737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0737_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 73 - 210
Target Start/End: Complemental strand, 35382715 - 35382578
Alignment:
Q |
73 |
agacttatcccaatgatctaattacaaaggtacaggaaattaaggcatgagccacagggtgtcagtcaaatagtacgaccggattgtgcaacccaagatt |
172 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35382715 |
agacttatcccaatgatctaattacaaaggtacaggaaattaaggcatgagccacagggtgtcagtcaaatagtacgaccggattgtgcaacccaagatt |
35382616 |
T |
 |
Q |
173 |
aattttgaaaaataagggcacaaataatgggaatggat |
210 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
35382615 |
aattttgaaaaataagggcacaaataatgggaatggat |
35382578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 113 - 198
Target Start/End: Complemental strand, 35387740 - 35387657
Alignment:
Q |
113 |
taaggcatgagccacagggtgtcagtcaaatagtacgaccggattgtgcaacccaagattaattttgaaaaataagggcacaaata |
198 |
Q |
|
|
|||||||||||||||| | | || |||||||||||| |||| |||||||| ||||| |||||||||| |||||||||||||||||| |
|
|
T |
35387740 |
taaggcatgagccacaag-tatctgtcaaatagtacaaccgaattgtgcagcccaatattaattttg-aaaataagggcacaaata |
35387657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3981 times since January 2019
Visitors: 4825