View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0737_low_20 (Length: 299)
Name: NF0737_low_20
Description: NF0737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0737_low_20 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 10 - 299
Target Start/End: Complemental strand, 52874619 - 52874330
Alignment:
| Q |
10 |
tccataacatatttaagaaactatcataaactagtacaaatataaggttacatgaaaaaaccttgggagataattcattatagcgttcatcaagctgatc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52874619 |
tccataacatatttaagaaactatcataaactagtacaaatataaggttacatgaaaaaaccttgggagataattcattatagcgttcatcaagctgatc |
52874520 |
T |
 |
| Q |
110 |
acgagcagttaagtctgaccataacgaagcacatataactgttccgacagacatcaaccacaaacatccaacagagaaatctatagttggacgagttgga |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52874519 |
acgagcagttaagtctgaccataacgaagcacatataactgttccgacagacatcaaccacaaacatccaacagagaaatctatagttggacgagttgga |
52874420 |
T |
 |
| Q |
210 |
gcatatagtagaacttccactgaaatgggcaatttaaaatcaaccaattgtaaatctcgtgcaaaaaggaatctaatagaaatatatgtt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52874419 |
gcatatagtagaacttccactgaaatgggcaattcaaaatcaaccaattgtaaatctcgtgcaaaaaggaatctaatagaaatatatgtt |
52874330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University