View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0737_low_21 (Length: 294)
Name: NF0737_low_21
Description: NF0737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0737_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 54 - 239
Target Start/End: Complemental strand, 18930299 - 18930114
Alignment:
Q |
54 |
agatgaagctcgaagcttgagctttctgcgatggttactgaagtgtagagtgaaaaagttaggattttgaagagaaggggttagtggtgatgatgaaaga |
153 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
18930299 |
agatgaagctcgaagcttgagctttctgcgatggttactgaagtgtagagtgaaaaagttaggattttgaagagatggggttagtggtgatgatgaaaga |
18930200 |
T |
 |
Q |
154 |
agaaatgggtttgaagtgtttggaaatttgagagccattgatggatttttctacatggagaaggaggttcttggtttcatttctgt |
239 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
18930199 |
agaaatgggtttgaagggtttggaaatttgagagccattgatggatttttctacatggagcaggaggttcttggtttcatttctgt |
18930114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University