View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0737_low_22 (Length: 291)
Name: NF0737_low_22
Description: NF0737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0737_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 43 - 230
Target Start/End: Original strand, 12989643 - 12989830
Alignment:
| Q |
43 |
atctagagttgtgtaacatagctttgaattgttagtctgtagttcatcatgcttcaagcctaggaggctttcacatgaatgatgctggatttatataaac |
142 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12989643 |
atctggagttgtgtaacatagctttgaattgttagtctgtagttcgtcatgcttcaagcctaggaggctttcacatgaatgatgctggatttatataaac |
12989742 |
T |
 |
| Q |
143 |
caaattatataactctaacattgcctgctagaacaatcaaaatattttaaattattgctaagaaaactcacccgttattgatgatgtc |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12989743 |
caaattatataactctaacattgcctgctagaacaatcaaaatattttaaatgattgctaagaaaactcacccgttatcgatgatgtc |
12989830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University