View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0737_low_25 (Length: 279)
Name: NF0737_low_25
Description: NF0737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0737_low_25 |
 |  |
|
[»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 92 - 279
Target Start/End: Original strand, 3890072 - 3890259
Alignment:
Q |
92 |
atccttaaattaattgagcgactttgatgaatgttatgtttatttataactgttgtgtgatttttctactcgcaggaatttaagggatatgtcttcaaaa |
191 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3890072 |
atccttaaattaattgagcgactttgatgaatgttatattgatttataactgttgtgtgatttttctactcgcaggaatttaagggatatgtcttcaaaa |
3890171 |
T |
 |
Q |
192 |
tcactggtggatgtgacaaacaaggctttccaatgaagcagggtgtgttaacccctggtcgtgttcgcctcttgctccacagaggtat |
279 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3890172 |
tcactggtggatgtgacaaacaaggctttccaatgaagcagggtgtgttaacccctggtcgtgttcgcctcttgctccacagaggtat |
3890259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 163 - 278
Target Start/End: Complemental strand, 35216873 - 35216758
Alignment:
Q |
163 |
gcaggaatttaagggatatgtcttcaaaatcactggtggatgtgacaaacaaggctttccaatgaagcagggtgtgttaacccctggtcgtgttcgcctc |
262 |
Q |
|
|
||||||||| ||||| || ||||||||||| |||||||| |||||||||||||| || |||||||||||||| ||||| || ||||| |||||| | ||| |
|
|
T |
35216873 |
gcaggaattcaagggttacgtcttcaaaattactggtgggtgtgacaaacaaggattcccaatgaagcagggagtgttgacacctggccgtgttaggctc |
35216774 |
T |
 |
Q |
263 |
ttgctccacagaggta |
278 |
Q |
|
|
|||||||| ||||||| |
|
|
T |
35216773 |
ttgctccatagaggta |
35216758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 164 - 278
Target Start/End: Original strand, 18699685 - 18699799
Alignment:
Q |
164 |
caggaatttaagggatatgtcttcaaaatcactggtggatgtgacaaacaaggctttccaatgaagcagggtgtgttaacccctggtcgtgttcgcctct |
263 |
Q |
|
|
||||||||||| ||||| || || |||||||| || || |||||||||||||| ||||||||||||||||| || | |||||||| |||||||| || | |
|
|
T |
18699685 |
caggaatttaaaggatacgtttttaaaatcaccggaggttgtgacaaacaaggatttccaatgaagcagggagtcctgacccctggccgtgttcgtctgt |
18699784 |
T |
 |
Q |
264 |
tgctccacagaggta |
278 |
Q |
|
|
|||| ||||| |||| |
|
|
T |
18699785 |
tgcttcacaggggta |
18699799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University