View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0737_low_26 (Length: 260)
Name: NF0737_low_26
Description: NF0737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0737_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 29 - 245
Target Start/End: Complemental strand, 30114457 - 30114240
Alignment:
Q |
29 |
attaatggtaattgatatggcactatcgctagtggggactagcaaatagcaatttcattttcagctcttgtagnnnnnnnaat-gcaattcaccatttat |
127 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |||||||||||||||| |
|
|
T |
30114457 |
attaatggtaattgatatggcactatcgctagtggggactagcaaatagcaatttcatcttcagctcttgtagttttttttattgcaattcaccatttat |
30114358 |
T |
 |
Q |
128 |
attgtaagcatctgaatgcagatatgtaaataccaaatgaagacaaaatctttttattttataccttgataattcttattgtatgattaatttgttattt |
227 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30114357 |
attgtaagcatctgaatgcagatatgtaaataccaaatgaagacaaaatctttttattttataccttgataattcttattgtatgattaatttgttattt |
30114258 |
T |
 |
Q |
228 |
agcacctccaccctcaat |
245 |
Q |
|
|
|||||||||||||||||| |
|
|
T |
30114257 |
agcacctccaccctcaat |
30114240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3142 times since January 2019
Visitors: 4805