View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0737_low_28 (Length: 255)

Name: NF0737_low_28
Description: NF0737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0737_low_28
NF0737_low_28
[»] chr2 (1 HSPs)
chr2 (122-255)||(32866670-32866803)


Alignment Details
Target: chr2 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 122 - 255
Target Start/End: Original strand, 32866670 - 32866803
Alignment:
122 attatactcacagcggcggcaacattcacatgcttgtaatcgtaaaatctccacagccaaatccaaccgaatacatagaaacaaatttgaactgtacctt 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
32866670 attatactcacagcggcggcaacattcacatgcttgtaatcgtaaaatctccacagccaaatccaaccgaatacatagaaacaaatctgaactgtacctt 32866769  T
222 nnnnnnngtgaacataaaatatacatattctcta 255  Q
           |||||||||||||||||||||||||||    
32866770 aaaaaaagtgaacataaaatatacatattctcta 32866803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 4588 times since January 2019
Visitors: 4836