View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0737_low_28 (Length: 255)
Name: NF0737_low_28
Description: NF0737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0737_low_28 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 6e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 122 - 255
Target Start/End: Original strand, 32866670 - 32866803
Alignment:
| Q |
122 |
attatactcacagcggcggcaacattcacatgcttgtaatcgtaaaatctccacagccaaatccaaccgaatacatagaaacaaatttgaactgtacctt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32866670 |
attatactcacagcggcggcaacattcacatgcttgtaatcgtaaaatctccacagccaaatccaaccgaatacatagaaacaaatctgaactgtacctt |
32866769 |
T |
 |
| Q |
222 |
nnnnnnngtgaacataaaatatacatattctcta |
255 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
32866770 |
aaaaaaagtgaacataaaatatacatattctcta |
32866803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University