View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0738_high_15 (Length: 278)
Name: NF0738_high_15
Description: NF0738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0738_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 41 - 222
Target Start/End: Original strand, 2672270 - 2672451
Alignment:
| Q |
41 |
gaaccgtataccgaagatgcagtaatcgatgaatcatccatttatctgcttaaacaaaacagtaaatgtcaaaagtgataatataaataacaacattaag |
140 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2672270 |
gaaccgtatagtgaagatgcagtaatcgatgaatcatccatttatctgtttagacaaaacagtaaatgtcaaaagtgataatataaataacaacattaag |
2672369 |
T |
 |
| Q |
141 |
gctctttatggtaaatataccctatatgacagtgagataaggttgttatcaaacacatttcatttttatcaaagaattatat |
222 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |||||| ||||||||||||||||| || ||||| |
|
|
| T |
2672370 |
gctctttatggtaaatatactctatatgacagtgagataaggttgttaccaaacagatttcatttttatcaaacaagtatat |
2672451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University