View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0738_high_21 (Length: 238)
Name: NF0738_high_21
Description: NF0738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0738_high_21 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 22 - 238
Target Start/End: Original strand, 18786939 - 18787155
Alignment:
| Q |
22 |
taaccaccgaaatcaaagtcaacacctaaatcaaaaccaaacccccaaataatcgtcgaaatcaaacttgagcgaaaatcacaaacgacattgtgaatgg |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||| ||||||||||||||| || ||||||||||| |
|
|
| T |
18786939 |
taaccaccgaaatcaaagtcaacacctaaatcaaaaccaaacccctaaataatcgtcgaaaccaaacttcagcgaaaatcacaaaggatattgtgaatgg |
18787038 |
T |
 |
| Q |
122 |
ccacatgcacaaattctaaaccgttgtcacccgctactcacaaaaatttctatnnnnnnnccatcaaactaatcaaaaccctgtgagcagaaacccatct |
221 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||| ||||||||||||||||||| ||||||||| ||||||||||||| ||||||| |||||||| |
|
|
| T |
18787039 |
ccacatgcacaaattccaaaccgttgtcatccggtactcacaaaaatttctataaaaaaaccatcaaaccaatcaaaaccctgcgagcagatacccatct |
18787138 |
T |
 |
| Q |
222 |
tctcatcactatagcta |
238 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
18787139 |
tctcatcactatagcta |
18787155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University