View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0738_low_27 (Length: 320)
Name: NF0738_low_27
Description: NF0738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0738_low_27 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 4e-66; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 99 - 320
Target Start/End: Complemental strand, 18787559 - 18787337
Alignment:
| Q |
99 |
aaatgattcacaatatatacaatgatcccacatcaacccacatggagattcctataatagcctgtgactagttgtaagattcacaacactcttctttttt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
18787559 |
aaatgattcacaatatatacaatgatcccacatctacccacatggagattcctataatagcctatgactagttgtaagattcacaacactcttct-tttt |
18787461 |
T |
|
| Q |
199 |
gagtttgttccgtttacgctaccgctctaattgttgacttcc-ttatgaannnnnnnncttgtattttgttgagat-aacgcttttactttgagatcgag |
296 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||| ||| ||| |||| ||||||||||| | | ||||||||||| ||||||||| |
|
|
| T |
18787460 |
gagtttgttctgtttacgctactgctctaattgttgacttcctttaggaatttgttttcttggattttgttgagttgatcgcttttacttcgagatcgag |
18787361 |
T |
|
| Q |
297 |
gattagtgtccagattcatgtttt |
320 |
Q |
| |
|
||||||||| || |||||||||| |
|
|
| T |
18787360 |
aattagtgtctagtttcatgtttt |
18787337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4842 times since January 2019
Visitors: 4840