View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0738_low_30 (Length: 315)
Name: NF0738_low_30
Description: NF0738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0738_low_30 |
 | |
|
| [»] scaffold1450 (2 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 8e-95; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 52 - 287
Target Start/End: Complemental strand, 8538951 - 8538717
Alignment:
| Q |
52 |
ataatactaagctttccaaataaaataaccgcaggccgacatgtcatacctactaaagtttaatattgaaaaattctaacttttaaaagttgagaatgca |
151 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| | |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8538951 |
ataatactaagctttccaaatgaaataaccgcag-cggacatgtcatacctactaaaatttaatattgaaaaattctaacttttaaaagttgagaatgca |
8538853 |
T |
|
| Q |
152 |
aacaaagctgagaatcttatccacagtatcaactatgtattttattgttgaattatctttgatataaaagtgtgtgtgctcttcgcgcaggcgtgcattt |
251 |
Q |
| |
|
||||||||| ||||||||||| ||| | |||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
8538852 |
aacaaagcttagaatcttatcaacattgtcaactatgtatttcattgttgaattatctttgatataaaagtgtgtgcgctcttcgcgcgggcgtgcattt |
8538753 |
T |
|
| Q |
252 |
gcctttgctaagctgtgtatgttgcttgtccttgat |
287 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
8538752 |
gcctttgctaagccttgtatgtcgcttgtccttgat |
8538717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 117 - 208
Target Start/End: Complemental strand, 8568103 - 8568012
Alignment:
| Q |
117 |
ttgaaaaattctaacttttaaaagttgagaatgcaaacaaagctgagaatcttatccacagtatcaactatgtattttattgttgaattatc |
208 |
Q |
| |
|
||||||||||||| || || |||||||||| |||||||||||| ||||||||||||||| | |||||||||||||| ||||||||||||| |
|
|
| T |
8568103 |
ttgaaaaattctagctcttcgaagttgagaaagcaaacaaagcttagaatcttatccacattgtcaactatgtatttcgttgttgaattatc |
8568012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1450 (Bit Score: 67; Significance: 9e-30; HSPs: 2)
Name: scaffold1450
Description:
Target: scaffold1450; HSP #1
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 138 - 236
Target Start/End: Complemental strand, 897 - 799
Alignment:
| Q |
138 |
aagttgagaatgcaaacaaagctgagaatcttatccacagtatcaactatgtattttattgttgaattatctttgatataaaagtgtgtgtgctcttcg |
236 |
Q |
| |
|
|||||||||| | ||||||| || ||||||||||||||| |||||||||||||||| ||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
897 |
aagttgagaaagtaaacaaaacttagaatcttatccacattatcaactatgtatttcattgttgaattatctttgatacaaaagtgtgtgcgctcttcg |
799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1450; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 52 - 129
Target Start/End: Complemental strand, 1022 - 945
Alignment:
| Q |
52 |
ataatactaagctttccaaataaaataaccgcaggccgacatgtcatacctactaaagtttaatattgaaaaattcta |
129 |
Q |
| |
|
|||||||||||||||||| || || ||||| || | ||||| ||||| |||||||| | ||||||||||||||||| |
|
|
| T |
1022 |
ataatactaagctttccatatgaattaaccacaagtggacatttcatatctactaaaaatcaatattgaaaaattcta |
945 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5818 times since January 2019
Visitors: 4859