View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0738_low_32 (Length: 314)
Name: NF0738_low_32
Description: NF0738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0738_low_32 |
 |  |
|
[»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 146 - 314
Target Start/End: Original strand, 7116801 - 7116975
Alignment:
Q |
146 |
tccaattttaatgtttttatttcatgatggagtaacagacaattccaaatttgaaattaatgtttatgatgatgatgcagcctgatcctgaaaagaagct |
245 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7116801 |
tccaattttaatgtttttatttcatgatggagtaacagacaattccaagtatgaaattaatgtttatgatgatgatgcagcctgatcctgaaaagaagct |
7116900 |
T |
 |
Q |
246 |
tcagaagtcaatgaccatgcccgtggccaacata------agggacccctttaatatgaacttacttgactcaaa |
314 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
T |
7116901 |
tcagaagtcaatgaccatgcccgtggccaacataagggacagggacccctttaatatgaacctacttgactcaaa |
7116975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 80 - 111
Target Start/End: Original strand, 7116743 - 7116774
Alignment:
Q |
80 |
gagatgaaaaatatatttaactcattaatttc |
111 |
Q |
|
|
|||||||||||||||||||||||||||||||| |
|
|
T |
7116743 |
gagatgaaaaatatatttaactcattaatttc |
7116774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University