View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0738_low_35 (Length: 287)
Name: NF0738_low_35
Description: NF0738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0738_low_35 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 4287531 - 4287381
Alignment:
| Q |
1 |
ttctattatctttaacaatgtagaaactaatcttctccaaatatttccggaaaacaatttaatcgttaaacatatagatttgagatttcattttcttaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4287531 |
ttctattatctttaacaatgtagaaactattcttctccaaatatttccggaaaacaattcaatcgttaaacatatagatttgagatttcattttcttaga |
4287432 |
T |
|
| Q |
101 |
gacctcgctaaagatggagtgagtgagctagttcatttcaacacaaatgat |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4287431 |
gacctcgctaaagatggagtgagtgagctagttcatttcaacacaaatgat |
4287381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 67 - 151
Target Start/End: Complemental strand, 19990314 - 19990230
Alignment:
| Q |
67 |
taaacatatagatttgagatttcattttcttagagacctcgctaaagatggagtgagtgagctagttcatttcaacacaaatgat |
151 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||| |||||||||| ||| ||| |||||||||| ||| ||||||||| |
|
|
| T |
19990314 |
taaacatattgatttgagatttcattttcttagtgacctcattaaagatggaatgattgatctagttcattacaaaacaaatgat |
19990230 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5671 times since January 2019
Visitors: 4858