View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0738_low_36 (Length: 285)
Name: NF0738_low_36
Description: NF0738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0738_low_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 47 - 234
Target Start/End: Complemental strand, 30621002 - 30620815
Alignment:
| Q |
47 |
atgaaatgtttcttccttgacaaacttcctggacctataatttgatgtgatttcattcactctgaagctagctgttgattgaatagttgtaatgtaatta |
146 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30621002 |
atgaaatgtttcttgcttgacaaacttcctggacctataatttgctgtgatttcattcactctgaagctagctgttgattgaatagttgtaatgtaatta |
30620903 |
T |
|
| Q |
147 |
aattgatttgtattttcttgttcttcattttttatattgaggaggttgtggatataataagnnnnnnntgatggatttgttgatgatg |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30620902 |
aattgatttgtattttcttgttcttcattttttatattgaggaggttgtggatataataagaaaaaaatgatggatttgttgatgatg |
30620815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5618 times since January 2019
Visitors: 4857