View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0738_low_37 (Length: 284)
Name: NF0738_low_37
Description: NF0738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0738_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 42 - 233
Target Start/End: Original strand, 18156268 - 18156458
Alignment:
| Q |
42 |
tgagatgaagatatccagaataaaataatcagnnnnnnntatacaatttatttannnnnnncgaatttgagaatatgattgcagtgcataaaaagacttg |
141 |
Q |
| |
|
|||||| |||||||||| || ||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18156268 |
tgagataaagatatccaaaaaaaaataatcagaaaaaa-tatacaatttatttatttttttcgaatttgagaatatgattgcagtgcataaaaagacttg |
18156366 |
T |
 |
| Q |
142 |
gatttattaaacatgcatagatctaacttcagctataactatctctatatgtctcttactttattgcagtcctatttgttcgggacagcaca |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18156367 |
gatttattaaacatgcatagatctaacttcagctataactatctctatatgtctcttactttattgcagtcctatttgttcgggacagcaca |
18156458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 69; Significance: 5e-31; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 42 - 169
Target Start/End: Original strand, 1904306 - 1904432
Alignment:
| Q |
42 |
tgagatgaagatatccagaataaaataatcagnnnnnnntatacaatttatttannnnnnncgaatttgagaatatgattgcagtgcataaaaagacttg |
141 |
Q |
| |
|
|||||| |||||||| | |||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1904306 |
tgagataaagatatcaaaaataaaataatcagaaaaaa-tatacaatttatttatttttttcgaatttgagaatatgattgcagtgcataaaaagacttg |
1904404 |
T |
 |
| Q |
142 |
gatttattaaacatgcatagatctaact |
169 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
1904405 |
gatttattaaacatgcatagatctaact |
1904432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University