View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0738_low_39 (Length: 283)
Name: NF0738_low_39
Description: NF0738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0738_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 63 - 237
Target Start/End: Complemental strand, 28930243 - 28930064
Alignment:
| Q |
63 |
cgattgcagcaaaaccagaaaacaattcattccaacctgacagaaataccatcaccttttaactgatagagcgccaag---gttnnnnnnnnnn--cagt |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
28930243 |
cgattgcagcaaaaccagaaaacaattcattccaacctgacagaaataccatcaccttttaactgatagagcgccaagaaggttaaaaaaaaaaaacagt |
28930144 |
T |
 |
| Q |
158 |
atttgaacagggaggttcactgaggtgattaatttgaacataccactattttctgaaatccgtgattgacaccatggttc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28930143 |
atttgaacagggaggttcactgaggtgattaatttgaacataacactattttctgaaatccgtgattgacaccatggttc |
28930064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University