View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0738_low_45 (Length: 275)

Name: NF0738_low_45
Description: NF0738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0738_low_45
NF0738_low_45
[»] chr6 (1 HSPs)
chr6 (38-181)||(3651431-3651572)


Alignment Details
Target: chr6 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 38 - 181
Target Start/End: Complemental strand, 3651572 - 3651431
Alignment:
38 ttctcaaataaaggtaaattaatactctaacatgacgtggagagtgannnnnnnnnnacttttgaaagttgacaggggaaaaatctggaccaaacataaa 137  Q
    |||||||||||| |||||||||||||||||||||||||||||||| |          |||||||||||||||||||||| |||||||||||||||||||     
3651572 ttctcaaataaaagtaaattaatactctaacatgacgtggagagtaatttttttt--acttttgaaagttgacaggggagaaatctggaccaaacataag 3651475  T
138 ctttggtgaagaaatgatatttaccatgaagtgcacaacattaa 181  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
3651474 ctttggtgaagaaatgatatttaccatgaagtgcacaacattaa 3651431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5910 times since January 2019
Visitors: 4860