View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0738_low_45 (Length: 275)
Name: NF0738_low_45
Description: NF0738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0738_low_45 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 38 - 181
Target Start/End: Complemental strand, 3651572 - 3651431
Alignment:
| Q |
38 |
ttctcaaataaaggtaaattaatactctaacatgacgtggagagtgannnnnnnnnnacttttgaaagttgacaggggaaaaatctggaccaaacataaa |
137 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| | |||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3651572 |
ttctcaaataaaagtaaattaatactctaacatgacgtggagagtaatttttttt--acttttgaaagttgacaggggagaaatctggaccaaacataag |
3651475 |
T |
 |
| Q |
138 |
ctttggtgaagaaatgatatttaccatgaagtgcacaacattaa |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3651474 |
ctttggtgaagaaatgatatttaccatgaagtgcacaacattaa |
3651431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University