View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0738_low_46 (Length: 274)
Name: NF0738_low_46
Description: NF0738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0738_low_46 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 7e-92; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 36 - 226
Target Start/End: Original strand, 42928118 - 42928308
Alignment:
| Q |
36 |
ataatatttagctttgagtaatttagtgattaaagaattcggacttgttactaatttccaagcttgcttgccaatcatagcaatgttgaaagctttgaga |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |||||||||||| |
|
|
| T |
42928118 |
ataatatttagctttgagtaatttagtgattaaagaattcggacttgttactagtttccaagcttgcttgccaatcatagccatgtttaaagctttgaga |
42928217 |
T |
|
| Q |
136 |
ttcttgaatcccatactgccgaagctcttcggagttgaaacacgctcccatgacatccagtgaattcctttagaatttgtggcatcatgac |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42928218 |
ttcttgaatcccatactgccgaagctcttcggagttgaaagacgctcccatgacatccagtgaattcctttagaatttgtggcattatgac |
42928308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 38 - 73
Target Start/End: Complemental strand, 12996018 - 12995983
Alignment:
| Q |
38 |
aatatttagctttgagtaatttagtgattaaagaat |
73 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12996018 |
aatatttagctttgagtaatttagtgatcaaagaat |
12995983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 38 - 73
Target Start/End: Original strand, 22698970 - 22699005
Alignment:
| Q |
38 |
aatatttagctttgagtaatttagtgattaaagaat |
73 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22698970 |
aatatttagctttgagtaatttagtgatcaaagaat |
22699005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 38 - 73
Target Start/End: Original strand, 30470053 - 30470088
Alignment:
| Q |
38 |
aatatttagctttgagtaatttagtgattaaagaat |
73 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30470053 |
aatatttagctttgagtaatttagtgatcaaagaat |
30470088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 38 - 73
Target Start/End: Original strand, 45275657 - 45275692
Alignment:
| Q |
38 |
aatatttagctttgagtaatttagtgattaaagaat |
73 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
45275657 |
aatatttagctttgagtaatttagtgatcaaagaat |
45275692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5683 times since January 2019
Visitors: 4858