View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0738_low_47 (Length: 274)

Name: NF0738_low_47
Description: NF0738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0738_low_47
NF0738_low_47
[»] chr2 (1 HSPs)
chr2 (39-274)||(31395680-31395915)


Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 39 - 274
Target Start/End: Original strand, 31395680 - 31395915
Alignment:
39 attgaatggttaaagcaatatatgctgaaatgagaatcataaaggttacaaaaagatggagtgtaaataaaattatataggcttaaaagtaagatataat 138  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| |||||||||||    
31395680 attgaatggttaaagcaatatatgctgaaatgagaatcataaaagttacaaaaagatgaagtgtaaataaaattatataggcttaaaaataagatataat 31395779  T
139 tttcaatttaactatatatgttggcagatacattgatgattagtacaaattggtttgagtaatttcaatggaaaggtacacaaagaagaaggacaattaa 238  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31395780 tttcaatttaactatatatgttggcagatacattgatgattagtacaaattggtttgagtaatttcaatggaaaggtacacaaagaagaaggacaattaa 31395879  T
239 agtcagtattacagggggtaatttcttctctttctc 274  Q
    ||||||||||||| ||||||||||||||||||||||    
31395880 agtcagtattacaaggggtaatttcttctctttctc 31395915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5830 times since January 2019
Visitors: 4859