View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0738_low_57 (Length: 262)
Name: NF0738_low_57
Description: NF0738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0738_low_57 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 30 - 262
Target Start/End: Original strand, 27261261 - 27261493
Alignment:
Q |
30 |
agtatagctgaacttagttctttaaacaaatatgcttgaagttaaatattcatatctataagcaagtttgaattcnnnnnnngcatagtggtattctagt |
129 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
27261261 |
agtatagctgaacttagttctttaaacaaatatgcttgaagttaaatattcatatctataagcaagtttgaattctttttttgcatagtggtattctagt |
27261360 |
T |
 |
Q |
130 |
tttcaaagtagcatgttggttaaaccatgtataatattaatgaacttcaattattattgtccatgtttatctacttagagcattttcagtagtgtcttgt |
229 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27261361 |
tttcaaagtagcatgttggttaaaccatgtataatattaatgaacttcaattattattgtccatgtttatctacttagagcattttcagtagtgtcttgt |
27261460 |
T |
 |
Q |
230 |
tgagctctagaagttaggaacaggttcttattt |
262 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
27261461 |
tgagctctagaagttaggaacaggttcttattt |
27261493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4773 times since January 2019
Visitors: 4839