View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0738_low_63 (Length: 249)
Name: NF0738_low_63
Description: NF0738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0738_low_63 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 30019360 - 30019498
Alignment:
Q |
1 |
gaagaagaagaaatcattgtttccttcaaaggttgtcatgttctttgcaaagagaaaaacacatccaagcaagtg-aatgtaattctttaactgaaaaga |
99 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
T |
30019360 |
gaagaagaagaaatcattgtttccttcaaaggttgtcatgttctttgcaaagagaaaaacacatccaagcaagtgaaatgtaattcttcaactgaaaaga |
30019459 |
T |
 |
Q |
100 |
agtacaatataagtgttgaactagtcttatttctgatga |
138 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30019460 |
agtacaatataagtgttgaactagtcttatttctgatga |
30019498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4779 times since January 2019
Visitors: 4839