View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0738_low_75 (Length: 217)
Name: NF0738_low_75
Description: NF0738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0738_low_75 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 38 - 78
Target Start/End: Complemental strand, 32215722 - 32215682
Alignment:
Q |
38 |
taagaattattgcttacacatagcaactagatgtaccaact |
78 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32215722 |
taagaattattgcttacacatagcaactagatgtaccaact |
32215682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5861 times since January 2019
Visitors: 4860