View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0738_low_77 (Length: 215)
Name: NF0738_low_77
Description: NF0738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0738_low_77 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 41531258 - 41531387
Alignment:
Q |
1 |
catgcctactattgtgttaccattggaatcttctatctataaattgaaagcaaaacattttattcatcacacacacaccaaaatcttaaatcgtctataa |
100 |
Q |
|
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| ||||| ||||| |||||||| |
|
|
T |
41531258 |
catgcccactattgtgttaccattggaatcttctatctataaattgaaagcaaaacattttattcatcacataaacaccgaaatcataaattgtctataa |
41531357 |
T |
 |
Q |
101 |
ctaatatctttagtgtttttcatctcactc |
130 |
Q |
|
|
||||||||||||||||||||| |||||||| |
|
|
T |
41531358 |
ctaatatctttagtgtttttcctctcactc |
41531387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 5711 times since January 2019
Visitors: 4858