View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0738_low_77 (Length: 215)

Name: NF0738_low_77
Description: NF0738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0738_low_77
NF0738_low_77
[»] chr5 (1 HSPs)
chr5 (1-130)||(41531258-41531387)


Alignment Details
Target: chr5 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 41531258 - 41531387
Alignment:
1 catgcctactattgtgttaccattggaatcttctatctataaattgaaagcaaaacattttattcatcacacacacaccaaaatcttaaatcgtctataa 100  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| ||||| ||||| ||||||||    
41531258 catgcccactattgtgttaccattggaatcttctatctataaattgaaagcaaaacattttattcatcacataaacaccgaaatcataaattgtctataa 41531357  T
101 ctaatatctttagtgtttttcatctcactc 130  Q
    ||||||||||||||||||||| ||||||||    
41531358 ctaatatctttagtgtttttcctctcactc 41531387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5711 times since January 2019
Visitors: 4858