View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0738_low_80 (Length: 213)
Name: NF0738_low_80
Description: NF0738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0738_low_80 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 12368306 - 12368193
Alignment:
Q |
1 |
ttaagtcagtaacgcaattgatttctcatttttcacaaggaaaatgcatagttgattttgagtgtaaatcccttcccttgtattggttagtacccccttg |
100 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12368306 |
ttaagtcagtaactcaattgatttctcatttttcacaaggaaaatgcatagttgattttgagtgtaaatcccttcccttgtattggttagtacccccttg |
12368207 |
T |
 |
Q |
101 |
atcaacgcacacta |
114 |
Q |
|
|
|||||||||||||| |
|
|
T |
12368206 |
atcaacgcacacta |
12368193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University