View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0738_low_82 (Length: 210)

Name: NF0738_low_82
Description: NF0738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0738_low_82
NF0738_low_82
[»] chr3 (1 HSPs)
chr3 (16-95)||(52239052-52239131)


Alignment Details
Target: chr3 (Bit Score: 80; Significance: 1e-37; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 16 - 95
Target Start/End: Original strand, 52239052 - 52239131
Alignment:
16 cacatattcttacgtattgtaatgttgacaacagtgagcgtatatttccttcctttcctttagaccattgttgtatcttc 95  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52239052 cacatattcttacgtattgtaatgttgacaacagtgagcgtatatttccttcctttcctttagaccattgttgtatcttc 52239131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 5359 times since January 2019
Visitors: 4850