View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0738_low_85 (Length: 201)
Name: NF0738_low_85
Description: NF0738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0738_low_85 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 29568446 - 29568485
Alignment:
| Q |
1 |
gtcgaaagaatgcttcttggatgatagttggtgagcagaa |
40 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29568446 |
gtcgaaagaatgcttcttggatgatagttggtgagcagaa |
29568485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 6 - 40
Target Start/End: Complemental strand, 27918668 - 27918634
Alignment:
| Q |
6 |
aagaatgcttcttggatgatagttggtgagcagaa |
40 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
27918668 |
aagaatgcttcttggatgatagttggtgagcagaa |
27918634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 29569777 - 29569815
Alignment:
| Q |
1 |
gtcgaaagaatgcttcttggatgatagttggtgagcaga |
39 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29569777 |
gtcggaagaatgcttcttggatgatagttggtgagcaga |
29569815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 4 - 40
Target Start/End: Complemental strand, 29168275 - 29168239
Alignment:
| Q |
4 |
gaaagaatgcttcttggatgatagttggtgagcagaa |
40 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29168275 |
gaaagaatgcttattggatgatagttggtgagcagaa |
29168239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 39
Target Start/End: Complemental strand, 29425315 - 29425281
Alignment:
| Q |
5 |
aaagaatgcttcttggatgatagttggtgagcaga |
39 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29425315 |
aaagaatgcttcttggatgatggttggtgagcaga |
29425281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 25518507 - 25518468
Alignment:
| Q |
1 |
gtcgaaagaatgcttcttggatgatagttggtgagcagaa |
40 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
25518507 |
gtcgaaagaatgcttcttggatgatggttggtgaggagaa |
25518468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 4974 times since January 2019
Visitors: 4844